Table 1

Primer sequences for RT-PCR

Gene nameGenBank accession no.Forward primer 5′–3′Reverse primer 5′–3′
AT1
Cx43
β-tubulin
NM_030985.4
NM_012567.2
NM_139254.2
TCTGACATCGTGGACACTGC
GACTGCTTCCTCTCACGTCC
CTGCTCATCAGCAAAGTGCG
CGTAGACAGGCTTGAGTGGG
CGCGATCCTTAACGCCTTTG
TGCGGAAGCAGATGTCGTAG