Table 1

Primer sequences for HAS1 3 RT-qPCR

Gene namePrimer sequence (5′ to 3′)
HAS1 Forward: CAAGATTCTTCAGTCTGGAC
Reverse: TAAGAACGAGGAGAAAGCAG
HAS2 Forward: CAGAATCCAAACAGACAGTTC
Reverse: TAAGGTGTTGTGTGTGACTG
HAS3 Forward: CTTAAGGGTTGCTTGCTTGC
Reverse: GTTCGTGGGAGATGAAGGAA
Arpo Forward: AGATGCAGCAGATCCGCAT
Reverse: GTGGTGATACCTAAAGCCTG
  • Arpo, acidic riboprotein PO; HAS, hyaluronan synthase; RT-qPCR, reverse transcription-quantitative PCR.