Table 1

RT primer of u6 and miRNA

Primer nameRT primer
U65’CGCTTCACGAATTTGCGTGTCAT3’
miR-155–5p5’GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACCCCT3’
miR-146b-5p5’GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAGCCTATG3’
miR-142–3p5’GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCCATAAA3’