Table 2

PCR primer of u6 and miRNA

Primer nameRT primer
U6F:5’GCTTCGGCAGCACATATACTAAAAT3’
R:5’CGCTTCACGAATTTGCGTGTCAT3’
miR-155–5pGSP:5’GGGTTAATGCTAATCGTGA3’
R:5’TGCGTGTCGTGGAGTC3’
miR-146b-5pGSP:5’GGGGGTGAGAACTGAATT3’
R:5’TGCGTGTCGTGGAGTC3’
miR-142–3pGSP:5’GGGGGTGTAGTGTTTCCTA3’ R:5’CAGTGCGTGTCGTGGA3’