Article Text

PDF
86 IS STACHYBOTRYS CHARTARUM A HEALTH RISK IN POST-KATRINA NEW ORLEANS?
  1. M. L. Juneau1,
  2. M. J. Ferris1,
  3. J. D. Norori1,
  4. J. E. Cutler1
  1. 1Louisiana State University Health Sciences Center, New Orleans, Research Institute for Children, New Orleans, LA.

Abstract

Stachybotrys chartarum, a nonpathogenic mold classified in the Fungi Imperfecti, is found ubiquitously in our environment and has been the source of much media attention in the last decade because of its penchant to form dense black biofilms on surfaces in water-damaged buildings. This so-called “toxic mold” can produce toxic secondary metabolites, most notably trichothecenes; however, the link to human disease remains controversial. Our long-term goal is to determine whether this fungus poses a health risk to workers and residents in contaminated structures. Our immediate focus is to identify fungal species growing in selected flooded and nonflooded homes and to determine their relative abundance in both air and surface samples. Air samples are collected onto selective and nonselective media and incubated at 22 to 23°C to obtain total colony counts for subsequent phenotypic and molecular identification. Samples are also collected onto cellophane tape for total conidial quantification. For molecular identification, sequence analysis of ITS regions is performed. DNA is extracted and PCR primers (ITS4 tcctccgcttattgatatgc and ITS5 ggaagtaaaagtcgtaacaagg) are used to amplify the ITS 1, 5.8S rRNA gene and ITS2 regions. In preliminary studies of Fusarium oxysporum, Cryptococcus neoformans, and Phialophora verrucosum isolates, ITS analyses showed that sequences matched (100% similarity) those of respective species in GenBank. We are currently developing similar approaches to identify fungi directly from wall and surfaces samples. Despite the great amount of media attention that S. chartarum has received, to our knowledge, no one has quantified S. chartarum in flooded and non-water-damaged areas of post-Katrina New Orleans.

Statistics from Altmetric.com

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.